AOAC 133rd Annual Meeting - Final Program

Poster Abstracts | Wednesday

P-W-087 Lijun Hu , Thomas Hammack , Eric Brown , Guodong Zhang , U.S. Food and Drug Administration, College Park, MD, USA; Li Ma , Oklahoma State University, Stillwater, OK, USA Development of a Loop-Mediated Isothermal Amplification (LAMP) Assay for the Detection of Salmonella ser. Typhimurium Quick and accurate molecular detection methods for food- borne pathogens are prerequisite of food safety. The objective of this study was to develop a LAMP assay for the detec- tion of Salmonella Typhimurium. The primers were designed by using PrimerExplorer V4 software, based on Salmonella ser. Typhimurium str. LT2 complete genome: STM3845 (NC_003197.1). Four sets of primers ranked top by the soft- ware were selected and evaluated for their effectiveness in detecting Salmonella ser. Typhimurium using isothermal master mix (OptiGene, UK), with 2 strains of Salmonella Typhimurium, 3 strains of Salmonella Enteritidis, and 2 strains of Salmonella Heidelberg. The ratio of outer and inner primers and the amount of DNA template per reaction for the assay were optimized for these primers. Results demonstrated that the following set of primers was determined to be effective in detecting Salmonella Typhimurium: F3 5 ʹ -TCTCCTTTTCGTGT- GTGG-3 ʹ , B3 5 ʹ - GATGAAATACTGGCTATATCATCT-3 ʹ , FIP 5 ʹ - GCATTTTTTGCTGTGTAAGTGAGTACGATGTAC GTGCACCAAT-3 ʹ , BIP 5 ʹ -CTTCACGAACATTTCATTCTAGC TGCAAACACCAGAAGGTCCG-3 ʹ . And the newly designed assay can differentiate Salmonella Typhimurium from Salmonella Enteritidis, Salmonella Heidelberg, other Salmonella serotypes, and non- Salmonella bacteria of pure cultures. Its effectiveness in detecting Salmonella Typhimurium in food products is being investigated. This new LAMP method could be another quick molecular tool for detecting Salmonella ser. Typhimurium in food products. Presenter: Guodong Zhang, U.S. Food and Drug Administration, College Park, MD, USA, Email: Guodong.Zhang@fda.hhs.gov P-W-088 Lijun Hu , Melanie Butler , Eric Brown , Thomas Hammack , Guodong Zhang , U.S. Food and Drug Administration, College Park, MD, USA; Li Ma , Oklahoma State University, Stillwater, OK, USA Validation of a Loop-Mediated Isothermal Amplification (LAMP) Method and PCR for the Detection of Salmonella ser. Enteritidis in Shell Eggs Rapid and accurate detection of Salmonella ser. Enteritidis (SE) in egg products is imperative for surveillance and outbreak inves- tigation. Our objective was to validate a prot 6E gene-based LAMP method developed in our laboratory and a PCR assay for detecting SE in shell eggs in comparison with FDA BAM culture method. We conducted 2 separate trials with 2 SE isolates of different phage types. Shell eggs were surface disinfected and cracked aseptically. Each trail consisted of 20 samples (inoc- ulated at ~5 cells/L), 5 positive controls (inoculated at ~50

one reaction. 74 V. parahaemolyticus , 26 V. vulnificus and 49 V. cholerae were tested for inclusivity with 100 % specificity. There were no false positive results for all 73 tested samples of 54 closely related species or bacteria of the same habitat. The sensitivity of the foodproof ® Vibrio Detection LyoKit is 1 genomic equivalent (GE) per reaction for species detection and 10-25 GE per reaction for toxin detection. The assay is compatible with all tested raw and processed seafood matrices like raw oysters or smoked salmon. The sample preparation includes a live/dead discrimination by using Reagent D, which efficiently removes DNA of at least 10 3 cfu/ml dead Vibrio . As seafood often is contaminated with dead Vibrio , Reagent D treatment prevents false positive results. Recently the foodproof Vibrio Detection method has been certified by the AOAC Performance Tested Methods SM program. Presenter: Hanna Hartenstein, BIOTECON Diagnostics, Potsdam, Germany, Email: hhartenstein@bc-diagnostics.com P-W-086 Michelle Rosauer , Christina Barnes , Raj Rajagopal , 3M, St Paul, MN, USA Rapid Detection of stx1, stx2, and EAE from Shiga Toxin-Producing Escherichia coli in Meat, Produce and Raw Dairy Samples Using Loop Mediated Isothermal Amplification (LAMP) and Bioluminescence Detection Shiga toxin-producing E. coli (STEC) are characterized by the production of Shiga toxins and intimin adhesin. The genes encoding these proteins ( stx1, stx2, and eae ) are commonly used for molecular detection of STEC. To evaluate the perfor- mance of a LAMP-bioluminescent gene screen method for the detection of STEC in food by comparison to reference PCR gene screen sequences described in USDA MLG 5C.00, FDA BAM Chapter 4A and ISO/TS 13136:2012. Inclusivity and exclusivity for 224 bacterial strains were assessed following AOAC guidelines. Method comparison in food was performed with raw meat (n=125), raw dairy (n=60), and leafy produce and sprouts (n=120). Matrices were analyzed as paired and unpaired samples using the LAMP-bioluminescent and reference method. Method comparison results were examined using the Discordant Analysis as described in ISO 16140-2:2016. The LAMP-bioluminescent assay demonstrated 100% inclusivity for 113 strains containing combinations of stx1, stx2, and eae genes and 100% exclusivity for 111 non-STEC strains. Matrix testing showed no significant differences between methods. The lowest concentration detected by the method was 1-5 CFU/sample, up to 375 g. The LAMP-bioluminescent method provides a rapid and specific approach for the detection of Shiga toxin ( stx1/ stx2 ) and intimin ( eae ) genes from STEC, and offers food manu- facturers and commercial laboratories results in 10-24 hours. Presenter: Michelle Rosauer, 3M, St Paul, MN, USA, Email: mlrosauer@mmm.com

WWW.AOAC.ORG 301.924.7077 109